GeneGlobe ID: DCG0000119 | Cat. No.: 250210 | dPCR CNV Probe Assays

dPCR CNV Probe Gene of Interest for IGF1R

Select a variant to see the price

Product Specification

Gene symbol: IGF1R
Ensembl Gene ID: ENSG00000140443
dPCR wet-lab validated
Product Name​
dPCR CNV Probe Gene of Interest for IGF1R
GeneGlobe Cat.No. (Assay ID)​
DCG0000119
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
IGF1R
Ensembl Gene ID​
ENSG00000140443
NCBI Gene Id​
3480
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
79
Amplicon region​
GAATTGCATGGTAGCCGAAGATTTCACAGTCAAAATCGGAGGTGTGTCCTTAGCTTTCCAGGTCTGGGCAAGAACTAAACTCAGGTGTTTTGAGGACTTTGTTGGCATT
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
FAM, ATTO550, Cy5, ATTO700
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 222.73 KBLanguage: English

Resources

Introducing the dPCR CNV Probe Gene of Interest for IGF1R, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for IGF1R facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for IGF1R and elevate your work to new heights.