GeneGlobe ID: DCG0000180 | Cat. No.: 250210 | dPCR CNV Probe Assays

dPCR CNV Probe Gene of Interest for EGFR

Select a variant to see the price

Product Specification

Gene symbol: EGFR
Ensembl Gene ID: ENSG00000146648
dPCR wet-lab validated
Product Name​
dPCR CNV Probe Gene of Interest for EGFR
GeneGlobe Cat.No. (Assay ID)​
DCG0000180
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
EGFR
Ensembl Gene ID​
ENSG00000146648
NCBI Gene Id​
1956
Strand​
Binds to forward (5’ to 3’) top genome strand
Amplicon length​
141
Amplicon region​
GGCAGCAGAGCTCCTGCTCTTCTTTGTCCTCATATACGAGCACCTCTGGACTTAAAACTTGAGGAACTGGATGGAGAAAAGTTAATGGTCAGCAGCGGGTTACATCTTCTTTCATGCGCCTTTCCATTCTTTGGATCAGTAGTCACTAACGTTCGCCAGCCATAAGTCCTC
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
FAM, ATTO550, Cy5, ATTO700
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 232.42 KBLanguage: English

Resources

Introducing the dPCR CNV Probe Gene of Interest for EGFR, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for EGFR facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for EGFR and elevate your work to new heights.