GeneGlobe ID: DMA00704 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Salmonella spp. (2)
Product Specification
Bacterial detection assay targeting the invasion protein (invA) gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Salmonella spp. (2)
GeneGlobe Cat.No. (Assay ID)
DMA00704
Target type
Microbial Id
Target region
Invasion protein (invA) gene
Target (NCBI taxonomy ID)
Salmonella (590)
Template accession
CP084194.1
Taxonomy
Bacteria
Secondary targets/specificity
Salmonella enterica (28901)
Bacillus cholerae-suis
Salmonella cholerae-suis
Salmonella choleraesuis
Salmonella enterica ser. choleraesuis
Salmonella bongori (54736)
Salmonella cholerae-suis subsp. bongori
Salmonella choleraesuis subsp. bongori
Salmonella enterica subsp. bongori
Salmonella enterica subsp. V
Salmonella enterica V
Bacillus cholerae-suis
Salmonella cholerae-suis
Salmonella choleraesuis
Salmonella enterica ser. choleraesuis
Salmonella bongori (54736)
Salmonella cholerae-suis subsp. bongori
Salmonella choleraesuis subsp. bongori
Salmonella enterica subsp. bongori
Salmonella enterica subsp. V
Salmonella enterica V
Application field
Human Pathogens
Wastewater & Drinking Water Epidemiology
Food Production
Wastewater & Drinking Water Epidemiology
Food Production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
No
Additional assay information
Assay based on proven sequences of mericon qPCR system
Region of Interest
TTGAAGCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCCTGGCGGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTG
Reaction size
200rxns
Product Resources
File Size: 190.65 KBLanguage: English
Resources
Available Product Catalog (2)
Kurzprotokolle (1)
Anwendungshinweise (2)
Technische Informationen (1)
Kit-Handbücher (1)
Wissenschaftliche Poster (1)
Broschüren und Leitfäden (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Application Notes (2)
Scientific Posters (1)
Technical Information (1)
Kit Handbooks (1)
Quick-Start Protocols (1)
Introducing the dPCR Microbial DNA Detection Assay for Salmonella spp. (2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Salmonella models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Salmonella spp. (2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Salmonella studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Salmonella spp. (2) and elevate your work to new heights.