GeneGlobe ID: DMA00750 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Hepatitis E virus
Product Specification
Viral detection assay
Alternative names of species: HEV
dPCR wet-lab validated
Alternative names of species: HEV
dPCR wet-lab validated
Product name
Hepatitis E virus
GeneGlobe Cat.No. (Assay ID)
DMA00750
Target type
Microbial Id
Target (NCBI taxonomy ID)
Hepatitis E virus (291484)
Hepatitis E virus HEV
Hepatitis E virus HEV
Template accession
JN564006.1
Taxonomy
Viruses
Application field
Wastewater & Drinking Water Epidemiology
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
AGCGGCGGTGCCGGCGGTGGTTTCTGGGGTGACAGGGTTGATTCTCAGCCCTTCGCCCTCCCCTATATTCATCCAACCAACCCCTTCGCCGCCGATGTCG
Reaction size
200rxns
Product Resources
File Size: 118.54 KBLanguage: English
Resources
Available Product Catalog (2)
Protocolos de inicio rápido (1)
Notas de aplicación (2)
Información técnica (1)
Manuales de uso de kits (1)
Carteles científicos (1)
Folletos y guías (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Application Notes (2)
Scientific Posters (1)
Technical Information (1)
Kit Handbooks (1)
Quick-Start Protocols (1)
Introducing the dPCR Microbial DNA Detection Assay for Hepatitis E virus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Hepatitis E virus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Hepatitis E virus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Hepatitis E virus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Hepatitis E virus and elevate your work to new heights.