dPCR CNV Probe Gene of Interest for ANKRD30A

Product Specification

Product Name

GeneGlobe Cat.No. (Assay ID)

DCG0000413

Assay type

Gene of Interest

Species

Human (Homo sapiens)

Gene symbol

ANKRD30A

Ensembl Gene ID

ENSG00000148513

NCBI Gene Id

91074

Strand

Binds to forward (5’ to 3’) top genome strand

Amplicon length

146

Amplicon region

ATATTCTGATAGATTCTGGTGCCGATATAAATCTCGTAGATGTGTATGGCAACACGGCTCTCCATTATGCTGTTTATAGTGAGATTTTGTCAGTGGTGGCAAAACTGCTGTCCCATGGTGCAGTCATCGAAGTGCACAACAAGGTAGACACTAACCAATGTTATTTTCAAAATATT

Recommended Reference Assay

TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)

Recommended Restriction Enzyme

CviQI, AluI, HaeIII, EcoRI, XbaI, PvuII

Wet-lab validated

dPCR wet-lab validated

Hydrolysis Probe

FAM, ATTO 550, Cy5

Primer Purification

Desalted

Probe Purification

HPLC

Resources

Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.

For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System

Introducing the dPCR CNV Probe Gene of Interest for ANKRD30A, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for ANKRD30A facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for ANKRD30A and elevate your work to new heights.

Country and Language

dPCR CNV Probe Gene of Interest for ANKRD30A

Select a variant to see the price help_outline

Product Specification

Resources

Select a variant to see the price