GeneGlobe ID: DMA00773 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Plasmodium malariae
Product Specification
Parasite detection assay
Alternative names of species: P. malariae
dPCR wet-lab validated
Alternative names of species: P. malariae
dPCR wet-lab validated
Product name
Plasmodium malariae
GeneGlobe Cat.No. (Assay ID)
DMA00773
Target type
Microbial Id
Target (NCBI taxonomy ID)
Plasmodium malariae (5858)
Template accession
MF693442.1
Taxonomy
Invertebrates
Application field
Tropical & Vector-borne Diseases
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TATTATACAATTTAAAATGTTATTTGGTGCAAGAGAATATTCTGTTCCAATTATATGGTTTATGTGTTCATTCTATGCTTTATTATGGATTGGATGTCAATTACCACAAGAAATTTTCATTTTATATGGTCGTCTATTTATTATATCATTCTTTTCTAGTGGTTTATTTGCACTTGTTCATTATAAAAGAA
Reaction size
200rxns
Product Resources
File Size: 89.21 KBLanguage: English
Resources
Available Product Catalog (2)
빠른 시작 프로토콜 (1)
애플리케이션 노트 (2)
기술 정보 (1)
키트 안내서 (1)
과학 포스터 (1)
브로셔 및 가이드 (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Brochures & Guides (2)
Application Notes (2)
Scientific Posters (1)
Technical Information (1)
Kit Handbooks (1)
Quick-Start Protocols (1)
Introducing the dPCR Microbial DNA Detection Assay for Plasmodium malariae, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Plasmodium malariae models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Plasmodium malariae facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Plasmodium malariae studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Plasmodium malariae and elevate your work to new heights.