The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-204 |
| Accession | MI0000284 |
| Genome Context | chr9: 70809975-70810084 [-] |
| Associated Mature miRNA | |
| Sequence | GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- cancer
- epithelial cancer
- epithelial neoplasia
- nonconvulsive seizure
- diabetic foot ulcer disorder
- renal clear cell adenocarcinoma
- renal clear cell cancer
- metastasis
- bladder cancer
role in cell
- apoptosis
- cell viability
- expression in
- proliferation
- differentiation
- activation in
- quantity
- migration
- antiapoptosis
- growth