The following mature miRNA have the same seed sequence: CAGGGAC
| ID | hsa-miR-211-3p |
| Accession | MIMAT0022694 |
| Sequence | 63 - GCAGGGACAGCAAAGGGGUGC - 83 |
| Seed Sequence | CAGGGAC |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
regulates
role in cell
- expression in
- cell viability
- Gap 0-Gap 1 phase