hsa-miR-455-3p miRCURY LNA miRNA PCR Assay

Product Specification

Pre-designed assay for dPCR and qPCR. Wet-lab validated for qPCR and dPCR.
Targets similar miRNAs across multiple species.

Name

hsa-miR-455-3p (YP00204035)

Species

Human (Homo sapiens)

Wet-lab validated

qPCR and dPCR wet-lab validated

miRBase ID

hsa-miR-455-3p

miRBase Accession

MIMAT0004784

Mature miRNA sequence

GCAGUCCAUGGGCAUAUACAC

Alternative targets

mml-miR-455-3p, aca-miR-455-3p, ggo-miR-455, oha-miR-455-3p, pbv-miR-455-3p, ppy-miR-455-3p, ptr-miR-455, ssc-miR-455-3p

miRBase ID

hsa-mir-455

miRBase Accession

MI0003513

Description

Homo sapiens miR-455 stem-loop

miRNA sequence (pre-miR)

UCCCUGGCGUGAGGGUAUGUGCCUUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAUGUCAUC

miRNAs amplified by this miRCURY LNA PCR Assay

hsa-miR-455-3p

Resources

Poster for download

For highly sensitive detection of miRNA using EvaGreen

For highly sensitive, real-time RT-PCR detection of miRNAs using SYBR Green

Here, we present a highly efficient, high-throughput workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, to accurately analyze miRNAs in well-defined individual cells and populations of cells.

Introducing the hsa-miR-455-3p miRCURY LNA miRNA PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA PCR Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Bornean orangutan models. Leveraging advanced technology, the hsa-miR-455-3p miRCURY LNA miRNA PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our miRCURY LNA miRNA PCR Assays collection ensures optimal efficiency and reproducibility for Bornean orangutan studies. Embrace the future of research with hsa-miR-455-3p miRCURY LNA miRNA PCR Assay and elevate your work to new heights.

Country and Language