GeneGlobe ID: DCG0000105 | Cat. No.: 250210 | dPCR CNV Probe Assays

dPCR CNV Probe Gene of Interest for HNF1A

Gene symbol: HNF1A
Ensembl Gene ID: ENSG00000135100
dPCR wet-lab validated

Select a variant to see the price

Product Specification

Product Name​
dPCR CNV Probe Gene of Interest for HNF1A
GeneGlobe Cat.No. (Assay ID)​
DCG0000105
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
HNF1A
Ensembl Gene ID​
ENSG00000135100
NCBI Gene Id​
6927
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
97
Amplicon region​
GCCAGGGAAGGGGAAGGTGACTCTAGGTCCTGTAAAAGGCTGTCCAGTTGCCGAGAACTCCTGATATTGGCTTAGCCTGGCCCAGAAAATTGAGAATACTTGAACCTAAGCCCATTCCTCGCAGCCC
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, AluI, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
FAM, ATTO 550, Cy5
Primer Purification​
Desalted
Probe Purification​
HPLC

Product Resources

Validation Data
File Size: 234.19 KBLanguage: English

Resources

Introducing the dPCR CNV Probe Gene of Interest for HNF1A, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for HNF1A facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for HNF1A and elevate your work to new heights.