QiagenGeneGlobe
Customize Analyze Knowledge Services
Biological Knowledge
Genes
microRNAs
Pathways
Tools
Oligo Tools
Panel Finder
NGS Sequencing Tools
Get to Know GeneGlobe
Video Tutorials
What's new
Events and Webinars
Unlock Deeper Insights with GeneGlobe Tutorials
Unlock Deeper Insights with GeneGlobe Tutorials
Explore intuitive guides and resources designed to help you get the most out of GeneGlobe. Whether you're designing assays, browsing curated panels, or diving into analysis tools—find practical help to accelerate your research journey.
Check this out!
null
null
GeneGlobe ID: DCG0000173 | Cat. No.: 250210 | dPCR CNV Probe Assays

dPCR CNV Probe Gene of Interest for ID1

Product Specification

Gene symbol: ID1
Ensembl Gene ID: ENSG00000125968
dPCR wet-lab validated
Product Name​
dPCR CNV Probe Gene of Interest for ID1
GeneGlobe Cat.No. (Assay ID)​
DCG0000173
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
ID1
Ensembl Gene ID​
ENSG00000125968
NCBI Gene Id​
3397
Strand​
Binds to forward (5’ to 3’) top genome strand
Amplicon length​
95
Amplicon region​
TGTCATTGGCAAGGGTCTAAGAATCTTCCTGGACATGTATGTGGATTTCTACTCAGGGGAGCATGTATGAGTGTCTACGCCTGTGTATGTAACAGGAGTAAGCTGATCTTCCCCCACTACTCCCA
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
CviQI, HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
FAM, ATTO550, Cy5, ATTO700
Primer Purification​
Desalted
Probe Purification​
HPLC
Reaction size​
300rxns, 500rxns and 1000rxns depending on selected dye

Resources

Available Product Catalog (2)
dPCR Probe CNV Assay Catalog
PDF (110.47 KB)
dPCR Probe CNV Assay Catalog
XLSX (30.3 KB)
Kit Handbooks (2)
Custom dPCR CNV Probe Assays Product Sheet
PDF (74KB)
dPCR Copy Number Variation (CNV) Probe Assays Handbook
PDF (309KB)
Application Notes (1)
A workflow combining high-accuracy cell sorting with multiplex digital PCR for mitochondrial and genomic target copy number analysis
PDF (2MB)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Scientific Posters (1)
Detection of rare events using the QIAcuity Digital PCR System
PDF (1MB)
Quick-Start Protocols (1)
dPCR CNV Probe Assays Quick-Start Protocol
PDF (124KB)
Brochures & Guides (1)
dPCR CNV Probe Assays Product Profile
PDF (736KB)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Safety Data Sheets (1)
Safety Data Sheets
Certificates of Analysis (1)
Certificates of Analysis
Introducing the dPCR CNV Probe Gene of Interest for ID1, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Copy Number Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for ID1 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Copy Number Analysis, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for ID1 and elevate your work to new heights.
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–25. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum