GeneGlobe ID: DMA00759 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Lactobacillus Pan (1/2)
Product Specification
For full pan coverage use in one reaction with Lactobacillus Pan (2/2) DMA00760, both assays labelled with same fluorophore
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Lactobacillus Pan (1/2)
GeneGlobe Cat.No. (Assay ID)
DMA00759
Target type
Microbial Id
Target region
16S Ribosomal RNA Gene
Target (NCBI taxonomy ID)
Lactobacillus (1578)
Paralactobacillus
Paralactobacillus
Template accession
OR647579.1
Taxonomy
Bacteria
Application field
Food production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGTAGTAACTGGCCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGTGCCAGCAGCCGCGGTA
Reaction size
200rxns
Product Resources
File Size: 76.56 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Lactobacillus Pan (1/2), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Lactobacillus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Lactobacillus Pan (1/2) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Lactobacillus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Lactobacillus Pan (1/2) and elevate your work to new heights.