GeneGlobe ID: DMA00777 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele)
Product Specification
Fungi detection assay
Alternative names of species: Erysiphe necator var. necator, Uncinula necator var. Necator oder Oidium tuckeri, Echter Mehltau
dPCR wet-lab validated
Alternative names of species: Erysiphe necator var. necator, Uncinula necator var. Necator oder Oidium tuckeri, Echter Mehltau
dPCR wet-lab validated
Product name
Erysiphe necator (Qol-sensitive containing wt G143 allele)
GeneGlobe Cat.No. (Assay ID)
DMA00777
Target type
Microbial Id
Target region
cytB
Target (NCBI taxonomy ID)
Erysiphe necator (52586)
grape powdery mildew
Uncinula necator
grape powdery mildew
Uncinula necator
Template accession
NC_056146.1
Taxonomy
Plants and Fungi
Application field
Food production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CAGCATTCTTGGGTTATGTTTTACCCTACGGGCAGATGAGCCTATGGGGTGCAACCGTTAAGTAGGTAATAGCGGTTGAAAAATATCACTATATGCTGGAAACTTCTAAAGCTTTAAGTAGGTGCGG
Reaction size
200rxns
Product Resources
File Size: 91.42 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Erysiphe necator models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Erysiphe necator studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Erysiphe necator (Qol-sensitive containing wt G143 allele) and elevate your work to new heights.