GeneGlobe ID: DMA00799 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Lachancea thermotolerans
Product Specification
Yeast detection assay
Alternative names of species: Zygosaccharomyces thermotolerans, Kluyveromyces thermotolerans
dPCR wet-lab validated
Alternative names of species: Zygosaccharomyces thermotolerans, Kluyveromyces thermotolerans
dPCR wet-lab validated
Product name
Lachancea thermotolerans
GeneGlobe Cat.No. (Assay ID)
DMA00799
Target type
Microbial Id
Target (NCBI taxonomy ID)
Lachancea thermotolerans (381046)
Kluyveromyces thermotolerans
Zygosaccharomyces thermotolerans
Kluyveromyces thermotolerans
Zygosaccharomyces thermotolerans
Template accession
NR_111334.1
Taxonomy
Plants and Fungi
Application field
Food production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
TTTGTTAGAGCAGCCGGGAAGTTCAGAAGCCTGCGCTTGATTGCGCGGCCGATGATGCTTTCTGTTAACGACTGTCTCTCTACACACACACTGTGGAGTAATTTATTTTACAACGCTTCTTCTTTGGGCTTTACGGCCCAAGGGTTACAAACACAAACAACTATTGTATTTTAAACACTGTCAATTATTTTTCATTTTAGAAAAAAAATATTTAAA
Reaction size
200rxns
Product Resources
File Size: 90.88 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Lachancea thermotolerans, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Lachancea thermotolerans models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Lachancea thermotolerans facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Lachancea thermotolerans studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Lachancea thermotolerans and elevate your work to new heights.