GeneGlobe ID: DMA00819 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Stenocarpella macrospora
Product Specification
Fungi detection assay
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Stenocarpella macrospora
GeneGlobe Cat.No. (Assay ID)
DMA00819
Target type
Microbial Id
Target (NCBI taxonomy ID)
Stenocarpella macrospora (371126)
Stenocarpella zeae
Stenocarpella zeae
Template accession
NR_157418.1
Taxonomy
Plants and Fungi
Application field
Food production
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CCCGGGCGCACCCAGAAACCCTTTGTGAACTCATACCTGACCGTTGCCTCGGCGCAGGCCGGCCCCCCCTGGGGGCCCCTCGGAGACGAGGAGCAGGCCCGCCGGCGGCCAAGTTAACCCTTGTTTTTACACCGGAACTCTGAGCAAAAACACAAATGAATCAAAA
Reaction size
200rxns
Product Resources
File Size: 90.89 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Stenocarpella macrospora, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Stenocarpella macrospora models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Stenocarpella macrospora facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Stenocarpella macrospora studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Stenocarpella macrospora and elevate your work to new heights.