GeneGlobe ID: DCG0000065 | Cat. No.: 250210 | dPCR CNV Probe Assays

dPCR CNV Probe Gene of Interest for RUNX1T1

Gene symbol: RUNX1T1
Ensembl Gene ID: ENSG00000079102
dPCR wet-lab validated

Select a variant to see the price

Product Specification

Product Name​
dPCR CNV Probe Gene of Interest for RUNX1T1
GeneGlobe Cat.No. (Assay ID)​
DCG0000065
Assay type​
Gene of Interest
Species​
Human (Homo sapiens)
Gene symbol​
RUNX1T1
Ensembl Gene ID​
ENSG00000079102
NCBI Gene Id​
862
Strand​
Binds to forward (5’ to 3’) top genome strand
Amplicon length​
111
Amplicon region​
TCGGCGTCACTGTACCGCCGGATCCAGTAATTCAATTCTTCCCGGTCTGCTTCTTGACACCGCCTTAGTACGGTGAGAGATCGCCTTGTTTTTTCTACCATGTCCATTATGCAGTTTAACAGCTATTTGGGAAAGGGGAGA
Recommended Reference Assay​
TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)
Recommended Restriction Enzyme​
HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
FAM, ATTO 550, Cy5
Primer Purification​
Desalted
Probe Purification​
HPLC

Product Resources

Validation Data
File Size: 228.14 KBLanguage: English

Resources

Introducing the dPCR CNV Probe Gene of Interest for RUNX1T1, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for RUNX1T1 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for RUNX1T1 and elevate your work to new heights.