GeneGlobe ID: YP02109703 | Cat. No.: 339306 | miRCURY LNA miRNA PCR Assays

hsa-miR-4484 miRCURY LNA miRNA PCR Assay

Product Specification

Pre-designed assay for dPCR and qPCR.
Targets similar miRNAs across multiple species.
Name​
hsa-miR-4484 (YP02109703)
Species​
Human (Homo sapiens)
Targets (mature miR)
miRBase ID​
hsa-miR-4484
miRBase Accession​
MIMAT0019018
Mature miRNA sequence​
AAAAGGCGGGAGAAGCCCCA
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-4484
miRBase Accession​
MI0016845
Description​
Homo sapiens miR-4484 stem-loop
miRNA sequence (pre-miR)​
GGGUUUCCUCUGCCUUUUUUUCCAAUGAAAAUAACGAAACCUGUUAUUUCCCAUUGAGGGGGAAAAAGGCGGGAGAAGCCCCA
miRNAs amplified by this miRCURY LNA PCR Assay​
hsa-miR-4484

Resources

Safety Data Sheets (1)
Kit Handbooks (3)
For highly sensitive detection of miRNA using EvaGreen
For highly sensitive, real-time RT-PCR detection of miRNAs using SYBR Green
Application Notes (1)
Here, we present a highly efficient, high-throughput workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, to accurately analyze miRNAs in well-defined individual cells and populations of cells.
Certificates of Analysis (1)
Introducing the hsa-miR-4484 miRCURY LNA miRNA PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA PCR Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the hsa-miR-4484 miRCURY LNA miRNA PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our miRCURY LNA miRNA PCR Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with hsa-miR-4484 miRCURY LNA miRNA PCR Assay and elevate your work to new heights.