dPCR CNV Probe Gene of Interest for THNSL2

Product Specification

Gene symbol: THNSL2
Ensembl Gene ID: ENSG00000144115
dPCR wet-lab validated

Product Name

dPCR CNV Probe Gene of Interest for THNSL2

GeneGlobe Cat.No. (Assay ID)

DCG0000522

Assay type

Gene of Interest

Species

Human (Homo sapiens)

Gene symbol

THNSL2

Ensembl Gene ID

ENSG00000144115

NCBI Gene Id

55258

Strand

Binds to reverse (3’ to 5’) bottom genome strand

Amplicon length

100

Amplicon region

GAGTGTTCAAGGGGCAAAGAACATGGACATTATCGTTCTGCTGCCCAAAGGTCACTGCACAAAGATTCAGGAGCTCCAGATGACAACGGTGCTGAAGCAGAACGTACATGTGTTTGGAGGTGTGTGCTGA

Recommended Reference Assay

TERT (DCR0000186), AP3B1 (DCR0000238), RPP30 (DCR0000181), AGO1 (DCR0000536)

Recommended Restriction Enzyme

HaeIII, EcoRI, XbaI, PvuII

Wet-lab validated

dPCR wet-lab validated

Hydrolysis Probe

FAM, ATTO 550, Cy5

Primer Purification

Desalted

Probe Purification

HPLC

Reaction size

300rxns, 500rxns and 1000rxns depending on selected dye

Product Resources

Validation Data

File Size: 229.71 KBLanguage: English

Resources

Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.

For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System

Introducing the dPCR CNV Probe Gene of Interest for THNSL2, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Gene of Interest for THNSL2 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Gene of Interest for THNSL2 and elevate your work to new heights.

Country and Language

dPCR CNV Probe Gene of Interest for THNSL2

Select a variant to see the price help_outline

Product Specification

Product Resources

Resources

Select a variant to see the price