GeneGlobe ID: DMA00679 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for stxA

Select a variant to see the price

Product Specification

Virulence gene detection assay targeting the bacterial shiga toxin Stx1 subunit A gene
dPCR wet-lab validated
Product name​
stxA
GeneGlobe Cat.No. (Assay ID)​
DMA00679
Target type​
Virulence
Target region​
Bacterial shiga toxin Stx1 subunit A gene
Target (NCBI taxonomy ID)​
Shiga toxin subunit A, RNA-N-glycosidase, catalyticsubunit
Template accession​
GQ429156.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
Yes, tested dye - ROX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TTCCAGGTACAACAGCGGTTACATTGTCTGGTGACAGTAGCTATACCACGTTACAGCGTGTTGCAGGGATCAGTCGTACGGGGATGCAGATAAATCGCCATTCGTTGACTACTTCTTATCTGGATTTAATGTCGCATAGTGGAACCTCACTGACGCAGTC
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 265.25 KBLanguage: English

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for stxA, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Shiga toxin subunit A, RNA-N-glycosidase, catalyticsubunit models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for stxA facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Shiga toxin subunit A, RNA-N-glycosidase, catalyticsubunit studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for stxA and elevate your work to new heights.