QiagenGeneGlobe
CustomizeAnalyzeKnowledgeToolsServices
icon_0009_cart-s Cart
null
null
Silencing of miRNA reporter assays with miRCURY LNA miRNA Mimics.
A unique triple strand design
Silencing of miRNA reporter assays with biotinylated miRCURY LNA miRNA Mimics.
Perfect miRNA strand-specific activity with miRCURY LNA miRNA Mimics.
Silencing of miRNA reporter assays with fluorescently labeled miRCURY LNA miRNA Mimics.
Fluorescently labeled miRNA mimics.
Biotinylated miRCURY LNA miRNA Mimics.
The distinct RNA triplex design ensures completely specific miRNA mimicry.
miRNA target identification with biotinylated mimics.
GeneGlobe ID: YM00471837 | Cat. No.: | miRCURY LNA miRNA Mimics

hsa-miR-4326 miRCURY LNA miRNA Mimic

Select a variant to see the price

Product Specification

MIMAT0016888: 5'UGUUCCUCUGUCUCCCAGAC

Resources

Safety Data Sheets (1)
Safety Data Sheets
Brochures & Guides (1)
RNA Functional Analysis – enhanced by LNA
PDF (1MB)
Kit Handbooks (1)
miRCURY LNA miRNA Mimics Handbook
PDF (121KB)
Certificates of Analysis (1)
Certificates of Analysis
Introducing the hsa-miR-4326 miRCURY LNA miRNA Mimic, a cutting-edge addition to our miRCURY LNA miRNA Mimics lineup, specifically designed for Functional Analysis applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the hsa-miR-4326 miRCURY LNA miRNA Mimic facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Functional Analysis, or any other sophisticated analyses, this product from our miRCURY LNA miRNA Mimics collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with hsa-miR-4326 miRCURY LNA miRNA Mimic and elevate your work to new heights.
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–25. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum