id | mmu-mir-297a-1 |
Accession | MI0000395 |
Comments | Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence [1]. This sequence appears to match several low complexity repetitive regions. Confidence in which loci actually express miR-297 is low because of the low complexity nature of the sequence. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. |
Database Links | mmu-mir-297a-1 |
Description | Mus musculus miR-297a-1 stem-loop |
Gene Family | MIPF0000204;mir-297 |
Genome Context | chr7: 10958437-10958512 [-] |
miRna Matures Links | |
Sequence | AUAUGUAUGUAUGUAUGUAUGUGUGCAUGUGCAUGUGCAUGUAUGCAUAUUGCAUGUAUAUAUUAUGCAUACAUGU |