id | rno-mir-101a |
Accession | MI0000886 |
Comments | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations. |
Database Links | rno-mir-101a |
Description | Rattus norvegicus miR-101a stem-loop |
Gene Family | MIPF0000046;mir-101 |
Genome Context | chr5: 120168437-120168511 [-] |
miRna Matures Links | |
Sequence | UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCCAUUCUAAAGGUACAGUACUGUGAUAACUGAAGGAUGGCA |