dPCR Microbial DNA Detection Assay for Salmonella spp. (2)

GeneGlobe ID: DMA00704 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the invasion protein (invA) gene
dPCR wet-lab verified
Product name​
Salmonella spp. (2)
GeneGlobe Cat.No. (Assay ID)​
DMA00704
Target type​
Microbial Id
Target region​
Invasion protein (invA) gene
Target (NCBI taxonomy ID)​
Salmonella (590)
Template accession​
CP084194.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Salmonella enterica (28901)
Bacillus cholerae-suis
Salmonella cholerae-suis
Salmonella choleraesuis
Salmonella enterica ser. choleraesuis
Salmonella bongori (54736)
Salmonella cholerae-suis subsp. bongori
Salmonella choleraesuis subsp. bongori
Salmonella enterica subsp. bongori
Salmonella enterica subsp. V
Salmonella enterica V
Application field​
Human Pathogens
Wastewater & Drinking Water Epidemiology
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - FAM
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
No
Additional assay information​
Assay based on proven sequences of mericon qPCR system
Region of Interest​
TTGAAGCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCCTGGCGGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 190.65 KBLanguage: English

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
seo_BottomDescription