Stem-loop dme-mir-219
Mirna Stemloop Summary
| id | dme-mir-219 |
| Accession | MI0000358 |
| Comments | This sequence is computationally predicted based on conservation in D. pseudoobscura [1]. The sequence of the excised miR is strikingly conserved in human (MIR:MI0000296), but the expression of the miR has not been confirmed in fly and the precise 5' or 3' ends are unknown. |
| Database Links | dme-mir-219 |
| Description | Drosophila melanogaster miR-219 stem-loop |
| Gene Family | MIPF0000044;mir-219 |
| Genome Context | chr3L: 17315006-17315105 [+] |
| miRna Matures Links | |
| Sequence | UAAUUCGAUUUUUAGCUAUGAUUGUCCAAACGCAAUUCUUGUUGAUAUUCAAUAUUCAAGGGUUGCGACUGGGCAUCGCGGCUCGAAAUAAGAAUACAAC |