id | dme-mir-92b |
Accession | MI0000379 |
Comments | miR-92b was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning. |
Database Links | dme-mir-92b |
Description | Drosophila melanogaster miR-92b stem-loop |
Gene Family | MIPF0000013;mir-25 |
Genome Context | chr3R: 25651398-25651497 [+] |
miRna Matures Links | |
Sequence | UAAAACGUCACCUGAUGUAGGCCGUGCCCAGUGCUUAUUUGUUGCAUUUUCGAAAUACAAAUUGCACUAGUCCCGGCCUGCAAUGAGUGUCGCAGUCGAC |