id | hsa-mir-124-1 |
Accession | MI0000443 |
Comments | miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations. |
Database Links | hsa-mir-124-1 |
Description | Homo sapiens miR-124-1 stem-loop |
Gene Family | MIPF0000021;mir-124 |
Genome Context | chr8: 9903388-9903472 [-] |
miRna Matures Links | |
Sequence | AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG |