dPCR CNV Probe Centromeric for PLEKHF1

Product Specification

Gene symbol: PLEKHF1
Ensembl Gene ID: ENSG00000166289
dPCR wet-lab validated
Centromeric 19 chromosome

Product Name

dPCR CNV Probe Centromeric for PLEKHF1

GeneGlobe Cat.No. (Assay ID)

DCC0000430

Assay type

Centromeric

Species

Human (Homo sapiens)

Gene symbol

PLEKHF1

Ensembl Gene ID

ENSG00000166289

NCBI Gene Id

79156

Strand

Binds to forward (5’ to 3’) top genome strand

Amplicon length

150

Amplicon region

CTCTTTGTGGAATGCAGTTCTGGTTTTGTCAGATTGTCCCTCAGCCAGGTACTCGGTGATCAGTCATGGTGGGACAGGTCAGTTCTGTCACTGGTAATCCCCTAGGTTTGCAGTATACAGCCAAGATCAGCAAGCTAAAAATAGCAGTTCTTACGTAAGGTAGTGTGGGCAGCCCTTCTC

Recommended Restriction Enzyme

HaeIII, EcoRI, XbaI, PvuII

Wet-lab validated

dPCR wet-lab validated

Hydrolysis Probe

HEX, ROX

Primer Purification

Desalted

Probe Purification

HPLC

Reaction size

300rxns and 1000rxns

Product Resources

Validation Data

File Size: 227.82 KBLanguage: English

Resources

Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.

For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System

Introducing the dPCR CNV Probe Centromeric for PLEKHF1, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Centromeric for PLEKHF1 facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Centromeric for PLEKHF1 and elevate your work to new heights.

Country and Language

dPCR CNV Probe Centromeric for PLEKHF1

Select a variant to see the price help_outline

Product Specification

Product Resources

Resources

Select a variant to see the price