GeneGlobe Design & Analysis Hub | Plan Your Experiments With Ease | GeneGlobe

Popular Applications

Browse products and analysis tools relevant to your research

Next Generation Sequencing

Functional Analysis

Localization Studies

Biology Research Topics

Browse Our Extensive Portfolio of dPCR and qPCR assays

Explore Gene Related Knowledge

Find Products

Configure Custom Products

Analyze Data

Explore Gene Related Knowledge

Access a wealth of information extracted from the literature and curated by our experts. Our collection includes over 10,000 manually curated biological entities, from miRNAs and genes to signaling pathways and interaction networks. Find information relevant to your research interests without the time-consuming literature searches and database queries.

Explore Knowledge

Find Products

GeneGlobe links our NGS, PCR and functional analysis products to manually curated data on >10,000 biological entities, so you can easily explore targets in their scientific context and find just the right tools to analyze them.

Browse By Application

Configure Custom Products

Our intuitive custom builders let you design exactly the assays, panels and oligos you need for your analysis in your preferred tube or plate format. Just provide a list of identifiers for your genes, miRNAs or proteins of interest and specify your plate layout, if applicable, and we will create a product customized just for you.

Open Custom Builders

Analyze Data

The GeneGlobe Data Analysis Center includes a range of web-based tools to streamline and simplify your data analysis. Access is complimentary when analyzing data acquired with QIAGEN kits, and our new pipelines support third-party kits on a pay-per-sample basis.

Explore Data Analysis Center

Featured Products

Featured

Next Generation Sequencing

Real Time PCR

Digital PCR

RNA Functional Analysis

Localization Studies

RT² Profiler PCR Arrays

For pathway-focused gene expression analysis using laboratory-verified assays

dPCR Microbial DNA Detection Assays

For digital PCR detection of microbial targets, including bacterial, fungal, parasitic, viral, antibiotic resistance or virulence factor genes

QuantiTect Primer Assays

For SYBR^® Green-based expression analysis of individual genes using bioinformatically-verified assays

miRCURY LNA miRNA PCR Assays

For extremely sensitive and specific miRNA quantification using LNA-optimized, SYBR^® Green-based miRNA PCR

Antisense LNA GapmeRs

For highly effective knockdown of mRNA and lncRNA using LNA-enhanced antisense oligonucleotides

QIAseq Targeted DNA Pro Panels

For unprecedented ease-of-use and biological insights using targeted DNA sequencing

QIAseq Targeted DNA Panels

Digital DNA sequencing to confidently detect low-frequency variants

QIAseq xHYB Viral and Bacterial Panels

For targeted viral and bacterial sequencing using hybrid capture

QIAseq Targeted cfDNA Ultra Panels

For ultrasensitive targeted next-generation sequencing of cfDNA on Illumina platforms

QIAseq miRNA Library Kit

Gel-free miRNA Sample to Insight solution for differential expression analysis and novel discovery using next-generation sequencing

RT² qPCR Primer Assays

For accurate and reliable gene expression analysis using laboratory-verified assays

miRCURY LNA miRNA Focus PCR Panels

For exceptionally sensitive and specific miRNA profiling using LNA-enhanced, SYBR^® Green-based miRNA qPCR

RT² Profiler™ PCR Array Human Fibrosis

Product.GeneGlobeID: PAHS-120Z

RT² Profiler PCR Array

QuantiNova LNA PCR Assays for Digital PCR

For in-depth, accurate and reliable gene expression analysis using LNA-enhanced, EvaGreen digital PCR

QuantiNova LNA Probe PCR Focus Panels

For in-depth pathway- or disease-specific gene expression analysis using LNA-enhanced, probe-based PCR

Staphylococcus aureus

Product.GeneGlobeID: DMA00302

Bacterial detection assay targeting the 16S ribosomal RNA gene dPCR wet-lab verified

dPCR LNA Mutation Assays

For detecting specific DNA sequence mutations related to cancer and oncogenesis

dPCR Mutation Assay JAK2 12600 Human

Product.GeneGlobeID: DMH0000021

AA Mutation: p.V617F Nucleotide Mutation: c.1849G>T dPCR wet-lab verified

dPCR Copy Number Assays

For locus-specific analysis of copy number variations and alterations

Staphylococcus aureus

Product.GeneGlobeID: DMA00302

Bacterial detection assay targeting the 16S ribosomal RNA gene dPCR wet-lab verified

FlexiTube siRNA

For efficient RNAi analysis one gene at a time

miRCURY LNA miRNA Mimics

For studies on miRNA function and gene regulation using synthetic miRNA

miRCURY LNA miRNA Inhibitors and Power Inhibitors

For miRNA loss-of-function studies using LNA-enhanced antisense miRNA inhibitors

AllStars Negative Control siRNA

For negative control RNAi experiments

Negative control A

Product.GeneGlobeID: YI00199006

miRCURY LNA miRNA Inhibitor Control

miRCURY LNA miRNA Detection Probes

For ultra-sensitive and specific miRNA detection by in situ hybridization (ISH) or Northern blotting

Custom LNA mRNA Detection Probes

For ultra-sensitive detection of mRNA and lncRNA by in situ hybridization and Northern blotting

ath-miR166a-3p miRCURY LNA miRNA Detection probe

Product.GeneGlobeID: YD00612445

targets mature miRNA: ath-miR166a-3p, aqc-miR166a, aqc-miR166c, aqc-miR166d, cme-miR166e, crt-miR166b, csi-miR166d, dpr-miR166a, lus-miR166e, lus-miR166f, mes-miR166j, mtr-miR166b, mtr-miR166c, mtr-miR166f, osa-miR166a-3p, osa-miR166g-3p, osa-miR166h-3p, osa-miR166m, pab-miR166a, pab-miR166b, ptc-miR166n, ptc-miR166o, ptc-miR166q, sbi-miR166f, sbi-miR166k, ssl-miR166a, stu-miR166b, tcc-miR166c, zma-miR166a-3p, zma-miR166l-3p, zma-miR166m-3p

MIMAT0000189: 5'UCGGACCAGGCUUCAUUCCCC

Custom miRCURY LNA miRNA Detection Probes

For ultra-sensitive and specific detection of novel miRNA sequences by in situ hybridization (ISH) or Northern blotting

beta-actin, hsa/mmu/rno Custom LNA Detection Probe lncRNA and mRNA

Product.GeneGlobeID: LCD0000001

5 nmol Control for Custom LNA mRNA Detection Probes

GeneGlobe - Your laboratory research companion

Where curated biology meets expert design - a platform built around the standards that genomics research depends on.

component pic

About GeneGlobe

Built on peer-reviewed knowledge, expert-curated pathways and validated assays, GeneGlobe gives researchers a foundation they can trust. Meet the methods, people and principles behind a platform supporting cancer, microbiome and translational genomics research.

Learn more about GeneGlobe

Have a question? Get in touch with us

What's New on GeneGlobe

New assays, curated insights and hands-on tutorials - keep up with what's just been added to support your research.

Expanded dPCR Microbial Assay Portfolio

Expanded dPCR Microbial Assay Portfolio

Evaluate microbial targets with nearly 1,000 dPCR assays, multiplex-ready bundles and validation data – built for surveillance and research workflows.

Inside the Tumor Microenvironment Pathway

Inside the Tumor Microenvironment Pathway

Map the cells, signals and ECM dynamics driving immune evasion, angiogenesis and metastasis in our newest cancer pathway resource.

Build Custom NGS Microbial Panels

Build Custom NGS Microbial Panels

Design targeted NGS panels for up to 20 viral species -including SARS-CoV-2 and Mpox - for surveillance and infectious disease research.

Popular Across the Research Community

Browse the pathways, genes, miRNAs and products most explored across GeneGlobe - a quick window into where the research community is focused.

Pathways

Genes

miRNAs

Products

PI3K/AKT Signaling Pathway

DNA Damage and Repair

G1/S Checkpoint Regulation

G2/M DNA Damage Checkpoint Regulation

Non-Homologous End Joining (NHEJ)

Apoptosis Signaling

Hematopoietic Stem Cells and Hematopoiesis

Pluripotent Stem Cells and Hematopoiesis

Cell Junction and Cytoskeleton-Related Signaling

Tumor Microenvironment (TME) Pathway

Transplant rejection

Oxidative Phosphorylation

Gap Junction Signaling

Nucleotide Excision Repair

RT2 Profiler PCR Array

QuantiTect Primer Assay

Microbial DNA qPCR Assay Kits

QIAseq Targeted DNA Panels

miRCURY LNA miRNA Mimics

QIAseq xHYB Viral and Bacterial Panels

Antisense LNA GapmeRs

dPCR Microbial DNA Detection Assays

RT2 qPCR Primer Assays

FlexiTube siRNA

miRCURY LNA miRNA PCR Assays

QIAseq FX DNA Library Kit

dPCR LNA Mutation Assays

Antisense LNA GapmeRs

QIAseq miRNA Library Kit

QIAseq FX DNA Library Kit

miRCURY LNA miRNA Inhibitors

QuantiNova LNA Probe PCR Focus Panels

Country and Language

Follow us

Contact us