Stem-loop mmu-mir-26a-2
Mirna Stemloop Summary
| id | mmu-mir-26a-2 |
| Accession | MI0000706 |
| Comments | This sequence is a second predicted hairpin precursor for miR-26a (MIR:MI0000573), conserved in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. |
| Database Links | mmu-mir-26a-2 |
| Description | Mus musculus miR-26a-2 stem-loop |
| Gene Family | MIPF0000043;mir-26 |
| Genome Context | chr10: 126995530-126995613 [+] |
| miRna Matures Links | |
| Sequence | GGCUGCGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUGUCCGUCCAUGAGGCCUGUUCUUGAUUACUUGUUUCUGGAGGCAGCG |