The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-21 |
| Accession | MI0000077 |
| Genome Context | chr17: 59841266-59841337 [+] |
| Associated Mature miRNA | |
| Sequence | UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- gastric cancer
- delayed hypersensitive reaction
- bleomycin-induced pulmonary fibrosis
- neoplasia
- metastasis
- liver cancer
- liver neoplasia
- digestive system cancer
- abdominal cancer
- cancer
role in cell
- formation
- phosphorylation in
- injury
- expression in
- apoptosis
- activation in
- signaling in
- proliferation
- survival
- cell viability