Stem-loop hsa-mir-7-1
Mirna Stemloop Summary
| id | hsa-mir-7-1 |
| Accession | MI0000263 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
| Database Links | hsa-mir-7-1 |
| Description | Homo sapiens miR-7-1 stem-loop |
| Gene Family | MIPF0000022;mir-7 |
| Genome Context | chr9: 83969748-83969857 [-] |
| miRna Matures Links | |
| Sequence | UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAUAACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG |