id | rno-let-7d |
Accession | MI0000601 |
Comments | Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons, including the sequence identical to the miRNA cloned from the reverse strand of mouse let-7d (MIR:MI0000405), named let-7* [1]. The predicted precursor sequence from a newer assembly of the rat genome also contains the let-7d sequence in the 5' arm. The let-7d* sequence published in [1] had an extra 3' A residue, which conflicts with the sequence of the precursor shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. |
Database Links | rno-let-7d |
Description | Rattus norvegicus let-7d stem-loop |
Gene Family | MIPF0000002;let-7 |
Genome Context | chr17: 16419980-16420077 [+] |
miRna Matures Links | |
Sequence | UGGGCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGAGAUUUUGCCCACAAGGAGUUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUU |