id | mmu-mir-7b |
Accession | MI0000730 |
Comments | miR-7 was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. This sequence represents the mouse homologue of human mir-7-3 -- the derived mature form differs at a single position from that expressed from mir-7-1 (MIR:MI0000728) and mir-7-2 (MIR:MI0000729) in mouse, and mir-7-1 (MIR:MI0000263), mir-7-2 (MIR:MI0000264) and mir-7-3 (MIR:MI0000265) in human. |
Database Links | mmu-mir-7b |
Description | Mus musculus miR-7b stem-loop |
Gene Family | MIPF0000022;mir-7 |
Genome Context | chr17: 56242988-56243098 [+] |
miRna Matures Links | |
Sequence | AGGAGCGGAGUACGUGAGCCAGUGCUAUGUGGAAGACUUGUGAUUUUGUUGUUCUGAUAUGAUAUGACAACAAGUCACAGCCAGCCUCAUAGCGUGGACUCCUAUCACCUU |