Stem-loop mmu-mir-199a-1

mmu-mir-199a-1

MI0000241

The hairpin precursor sequence mir-199 maps to two loci within 50 kb on mouse chromosome 9. This sequence was named mir-199 in [1] and [2], but is renamed here to avoid overlap with the predicted homologues of human mir-199a-2 and mir-199b. Landgraf et al. demonstrate comparable expression for products from both arms of the hairpin, which are therefore renamed miR-199a-5p and miR-199a-3p here [4]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Mus musculus miR-199a-1 stem-loop

MIPF0000040;mir-199

chr9: 21496495-21496564 [-]

GCCAUCCCAGUGUUCAGACUACCUGUUCAGGAGGCUGGGACAUGUACAGUAGUCUGCACAUUGGUUAGGC