id | mmu-mir-199a-1 |
Accession | MI0000241 |
Comments | The hairpin precursor sequence mir-199 maps to two loci within 50 kb on mouse chromosome 9. This sequence was named mir-199 in [1] and [2], but is renamed here to avoid overlap with the predicted homologues of human mir-199a-2 and mir-199b. Landgraf et al. demonstrate comparable expression for products from both arms of the hairpin, which are therefore renamed miR-199a-5p and miR-199a-3p here [4]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations. |
Database Links | mmu-mir-199a-1 |
Description | Mus musculus miR-199a-1 stem-loop |
Gene Family | MIPF0000040;mir-199 |
Genome Context | chr9: 21496495-21496564 [-] |
miRna Matures Links | |
Sequence | GCCAUCCCAGUGUUCAGACUACCUGUUCAGGAGGCUGGGACAUGUACAGUAGUCUGCACAUUGGUUAGGC |