id | rno-mir-343 |
Accession | MI0000628 |
Comments | Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains a 3' terminal UU sequence, which conflicts with the precursor sequence shown here. |
Database Links | rno-mir-343 |
Description | Rattus norvegicus miR-343 stem-loop |
Gene Family | MIPF0000411;mir-343 |
Genome Context | chr1: 80298686-80298778 [+] |
miRna Matures Links | |
Sequence | GCACCUUCAUGGACCUGGAGUAGAGUGGGUGUGGCGGGGGGAGCAGGGCCCAGGGCAACCUCUCCCUCCGUGUGCCCAGAUCCUGCAUGCCAA |