QiagenGeneGlobe
Applications
Custom ProductsAnalyze DataKnowledgeToolsServices
0 Cart
GeneGlobe ID: DCR0000186 | Cat. No.: 250213 | dPCR CNV Probe Assays

dPCR CNV Probe Reference for TERT

Gene symbol: TERT
Ensembl Gene ID: ENSG00000164362
dPCR wet-lab validated

Select a variant to see the price

Product Specification

Product Name​
dPCR CNV Probe Reference for TERT
GeneGlobe Cat.No. (Assay ID)​
DCR0000186
Assay type​
Reference
Species​
Human (Homo sapiens)
Gene symbol​
TERT
Ensembl Gene ID​
ENSG00000164362
NCBI Gene Id​
7015
Strand​
Binds to reverse (3’ to 5’) bottom genome strand
Amplicon length​
113
Amplicon region​
CATAAATAAAGTAACATTCTCCAAAGCGGTTAAATGAAAAACTTAAATTTCTTTCCAACAGACGAGCTCTCTACAGTTAACTGCTACAGCAATTCCTCATTCATTATAAGTACTCAGTGTTTACCATCAGCTTGTGCAATTCT
Recommended Restriction Enzyme​
HaeIII, EcoRI, XbaI, PvuII
Wet-lab validated​
dPCR wet-lab validated
Hydrolysis Probe​
HEX, ROX
Primer Purification​
Desalted
Probe Purification​
HPLC

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 229.25 KBLanguage: English

Resources

Kit Handbooks (2)
Custom dPCR CNV Probe Assays Product Sheet
PDF (74KB)
dPCR Copy Number Variation (CNV) Probe Assays Handbook
PDF (320KB)
Application Notes (1)
A workflow combining high-accuracy cell sorting with multiplex digital PCR for mitochondrial and genomic target copy number analysis
PDF (2MB)
Here, we present a workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, which accelerate and streamline high-throughput analyses of target copy numbers in cultured cells. The workflow starts with detecting and sorting defined populations of cells as well as individual cells using cellenONE, followed by multiplexing dPCR on the QIAcuity platform. Copy number variations of target regions are then analyzed using the QIAcuity Software Suite, providing an intuitive and fast interpretation of results.
Scientific Posters (1)
Detection of rare events using the QIAcuity Digital PCR System
PDF (1MB)
Quick-Start Protocols (1)
dPCR CNV Probe Assays Quick Start Protocol
PDF (86KB)
Brochures & Guides (1)
dPCR CNV Probe Assays Product Profile
PDF (736KB)
For locus-specific copy number variation (CNV) analysis using the QIAcuity Digital PCR System
Safety Data Sheets (1)
Safety Data Sheets
Certificates of Analysis (1)
Certificates of Analysis
Introducing the dPCR CNV Probe Reference for TERT, a cutting-edge addition to our dPCR CNV Probe Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the dPCR CNV Probe Reference for TERT facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR CNV Probe Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with dPCR CNV Probe Reference for TERT and elevate your work to new heights.
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–24. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum