GeneGlobe ID: DMA00720 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for RNAseP(g)
Product Specification
Human detection assay
Alternative names of species: RNAseP
dPCR wet-lab validated
Alternative names of species: RNAseP
dPCR wet-lab validated
Product name
RNAseP(g)
GeneGlobe Cat.No. (Assay ID)
DMA00720
Target type
Microbial Id
Target region
human RNAse P gene
Target (NCBI taxonomy ID)
Homo sapiens (9606)
human
human
Taxonomy
Primates
Application field
Positive Control Assay
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, CviQI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
CATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAG
Reaction size
200rxns
Product Resources
File Size: 109.39 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for RNAseP(g), a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Hepacivirus hominis models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for RNAseP(g) facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Hepacivirus hominis studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for RNAseP(g) and elevate your work to new heights.