QiagenGeneGlobe
Custom Products Analyze Knowledge Services
Biological Knowledge
Genes
microRNAs
Pathways
Tools
Assay Wizard
Oligo Tools
Panel Finder
NGS Sequencing Tools
Get to Know GeneGlobe
Video Tutorials
What's new
Events and Webinars
Unlock Deeper Insights with GeneGlobe Tutorials
Unlock Deeper Insights with GeneGlobe Tutorials
Explore intuitive guides and resources designed to help you get the most out of GeneGlobe. Whether you're designing assays, browsing curated panels, or diving into analysis tools—find practical help to accelerate your research journey.
Check this out!
icon_0009_cart-s Cart icon_0071_person-s My Account
null
null
A simple and rapid plate-based workflow

dPCR Microbial DNA Detection Assay for Brevibacillus agri

GeneGlobe ID: DMA00069 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
Product name​
Brevibacillus agri
GeneGlobe Cat.No. (Assay ID)​
DMA00069
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Brevibacillus agri (51101)
Bacillus agri
Bacillus galactophilus
Bacillus pulvifaciens group II
Template accession​
AB039334.1
Taxonomy​
Bacteria
Application field​
Human Pathogens
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ATACCGGATAGGTTTTTGGATCGCATGATCTGAAAAGAAAAGATGGCTTTTCGCTATCACTGGGAGATGGGCCTGCGGCGCATTAGCTAGTTGGTGGGGTAACGGCCTACCAAGGCGACGATGCGTAGCCG
Reaction size​
200rxns

Resources

Available Product Catalog (2)
dPCR Microbial Detection Assay Catalog
PDF (268.42 KB)
dPCR Microbial Detection Assay Catalog
XLSX (92.93 KB)
Quick-Start Protocols (1)
dPCR Microbial DNA Detection Assays and Custom dPCR Microbial Assays Quick-Start Protocol
PDF (675KB)
Application Notes (2)
Advancing higher-order multiplex PCR: Overcoming the limitations of qPCR with QIAcuity digital PCR
PDF (3MB)
Higher-order multiplexing on QIAcuity: 12-plex dPCR capabilities for detailed biological analysis
PDF (563KB)
Technical Information (1)
dPCR Microbial DNA Detection Assays - Assay/target list
PDF (200KB)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Microbial DNA dPCR Handbook
PDF (449KB)
Scientific Posters (1)
Accurate and sensitive detection of microbial DNA and RNA targets using nanoplate dPCR
PDF (322KB)
Brochures & Guides (2)
dPCR Microbial DNA Detection Assays Product Profile
PDF (405KB)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Making the invisible visible
PDF (2MB)
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Safety Data Sheets
Certificates of Analysis (1)
Certificates of Analysis
Introducing the dPCR Microbial DNA Detection Assay for Brevibacillus agri, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Brevibacillus agri models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Brevibacillus agri facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Brevibacillus agri studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Brevibacillus agri and elevate your work to new heights.
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–26. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum