GeneGlobe ID: DMA00291 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Salmonella enterica
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Salmonella enterica
GeneGlobe Cat.No. (Assay ID)
DMA00291
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Salmonella enterica (28901)
Bacillus cholerae-suis
Salmonella cholerae-suis
Salmonella choleraesuis
Salmonella enterica ser. choleraesuis
Bacillus cholerae-suis
Salmonella cholerae-suis
Salmonella choleraesuis
Salmonella enterica ser. choleraesuis
Template accession
NC_011094.1
Taxonomy
Bacteria
Secondary targets/specificity
Citrobacter amalonaticus (35703)
Citrobacter intermedius biogroup a
Levinea amalonatica
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Enterobacter ludwigii (299767)
Citrobacter intermedius biogroup a
Levinea amalonatica
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Enterobacter ludwigii (299767)
Application field
Human Pathogens
Wastewater & Drinking Water Epidemiology
Food Production
Wastewater & Drinking Water Epidemiology
Food Production
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
TCAGATGTGCCCAGATGGGATTAGCTTGTTGGTGAGGTAACGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGTGTTGTGGTTAATAACCGCAGCAATTGACGTTACCCGCAGAAGAA
Reaction size
200rxns
Product Resources
File Size: 240.13 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Salmonella enterica, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Citrobacter amalonaticus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Salmonella enterica facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Citrobacter amalonaticus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Salmonella enterica and elevate your work to new heights.