QiagenGeneGlobe
Custom Products Analyze Knowledge Services
Biological Knowledge
Genes
microRNAs
Pathways
Tools
Oligo Tools
Panel Finder
NGS Sequencing Tools
Get to Know GeneGlobe
Video Tutorials
What's new
Events and Webinars
Unlock Deeper Insights with GeneGlobe Tutorials
Unlock Deeper Insights with GeneGlobe Tutorials
Explore intuitive guides and resources designed to help you get the most out of GeneGlobe. Whether you're designing assays, browsing curated panels, or diving into analysis tools—find practical help to accelerate your research journey.
Check this out!
icon_0009_cart-s Cart icon_0071_person-s My Account
null
null
A simple and rapid plate-based workflow
GeneGlobe ID: DMA00291 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Salmonella enterica

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Salmonella enterica
GeneGlobe Cat.No. (Assay ID)​
DMA00291
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Salmonella enterica (28901)
Bacillus cholerae-suis
Salmonella cholerae-suis
Salmonella choleraesuis
Salmonella enterica ser. choleraesuis
Template accession​
NC_011094.1
Taxonomy​
Bacteria
Secondary targets/specificity​
Citrobacter amalonaticus (35703)
Citrobacter intermedius biogroup a
Levinea amalonatica
Enterobacter cloacae (550)
Aerobacter cloacae
Bacillus cloacae
Bacterium cloacae
Cloaca cloacae
Enterobacter ludwigii (299767)
Application field​
Human Pathogens
Wastewater & Drinking Water Epidemiology
Food Production
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TCAGATGTGCCCAGATGGGATTAGCTTGTTGGTGAGGTAACGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGTGTTGTGGTTAATAACCGCAGCAATTGACGTTACCCGCAGAAGAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 240.13 KBLanguage: English

Resources

Available Product Catalog (2)
dPCR Microbial Detection Assay Catalog
PDF (268.14 KB)
dPCR Microbial Detection Assay Catalog
XLSX (92.91 KB)
Quick-Start Protocols (1)
dPCR Microbial DNA Detection Assays and Custom dPCR Microbial Assays Quick-Start Protocol
PDF (675KB)
Application Notes (2)
Advancing higher-order multiplex PCR: Overcoming the limitations of qPCR with QIAcuity digital PCR
PDF (3MB)
Higher-order multiplexing on QIAcuity: 12-plex dPCR capabilities for detailed biological analysis
PDF (563KB)
Technical Information (1)
dPCR Microbial DNA Detection Assays - Assay/target list
PDF (200KB)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Microbial DNA dPCR Handbook
PDF (449KB)
Scientific Posters (1)
Accurate and sensitive detection of microbial DNA and RNA targets using nanoplate dPCR
PDF (322KB)
Brochures & Guides (2)
dPCR Microbial DNA Detection Assays Product Profile
PDF (405KB)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Making the invisible visible
PDF (2MB)
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Safety Data Sheets
Certificates of Analysis (1)
Certificates of Analysis
seo_BottomDescription
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–26. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum