GeneGlobe ID: DMA00319 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Streptococcus pyogenes

Select a variant to see the price

Product Specification

Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
Product name​
Streptococcus pyogenes
GeneGlobe Cat.No. (Assay ID)​
DMA00319
Target type​
Microbial Id
Target region​
16S ribosomal RNA gene
Target (NCBI taxonomy ID)​
Streptococcus pyogenes (1314)
Micrococcus scarlatinae
Streptococcus erysipelatos
Streptococcus hemolyticus
Streptococcus scarlatinae
Template accession​
NC_004606.1
Taxonomy​
Bacteria
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - HEX
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TTTTAAATTACTAACATGCGTTAGTCTCTCTTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGCTATGAGGTAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCCTTGAACCGGTGCAAGCACCAGTTCTCAGCGTTCTACTTGCATGTATTAGGCACG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 250.09 KBLanguage: English

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Streptococcus pyogenes, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with Acinetobacter beijerinckii models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Streptococcus pyogenes facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Acinetobacter beijerinckii studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Streptococcus pyogenes and elevate your work to new heights.