GeneGlobe ID: DMA00320 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Streptococcus salivarius
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Streptococcus salivarius
GeneGlobe Cat.No. (Assay ID)
DMA00320
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Streptococcus salivarius (1304)
Streptococcus salivarius subsp. salivarius
Streptococcus salivarius subsp. salivarius
Template accession
NZ_ACLO01000035.1
Taxonomy
Bacteria
Secondary targets/specificity
Streptococcus thermophilus (1308)
Streptococcus salivarius subsp. thermophilus
Streptococcus salivarius thermophilus
Streptococcus salivarius subsp. thermophilus
Streptococcus salivarius thermophilus
Application field
Human Microbiome
Probiotics
Probiotics
Wet-lab tested in singleplex
Yes, tested dye - HEX
Wet-lab tested in multiplex
Yes
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Region of Interest
CGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGATGACACATGTCATTTATTTGAAAGGGGCAATTGCTCCACTACAAGAT
Reaction size
200rxns
Product Resources
File Size: 258.78 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Streptococcus salivarius, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Bifidobacterium bifidum models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Streptococcus salivarius facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Bifidobacterium bifidum studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Streptococcus salivarius and elevate your work to new heights.