GeneGlobe ID: DMA00355 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Campylobacter spp.
Product Specification
Bacterial detection assay targeting the 16S ribosomal RNA gene
dPCR wet-lab validated
dPCR wet-lab validated
Product name
Campylobacter spp.
GeneGlobe Cat.No. (Assay ID)
DMA00355
Target type
Microbial Id
Target region
16S ribosomal RNA gene
Target (NCBI taxonomy ID)
Campylobacter (194)
Template accession
NC_003912.7
Taxonomy
Bacteria
Application field
Infectious Diseases
Food Production
Human Pathogens
Food Production
Human Pathogens
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI
Template present in Microbial DNA Positive Control
Yes
Additional assay information
Assay based on proven sequences of mericon qPCR system
Region of Interest
ATGCCCAGGGCGACACACGTGCTACAATGGCATATACAATGAGACGCAATACCGCGAGGTGGAGCAAATCTATAAAATATGTCCCAGTTCGGATTGTTCTCTGCAACTCGAGAGCATGAAGCCGGAATCGCTAGTAAT
Reaction size
200rxns
Product Resources
File Size: 235.93 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Campylobacter spp., a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Campylobacter models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Campylobacter spp. facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Campylobacter studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Campylobacter spp. and elevate your work to new heights.