GeneGlobe ID: DMA00372 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Human metapneumovirus

Select a variant to see the price

Product Specification

Viral detection assay targeting the fusion protein (F) gene
dPCR wet-lab validated
Product name​
Human metapneumovirus
GeneGlobe Cat.No. (Assay ID)​
DMA00372
Target type​
Microbial Id
Target region​
Fusion protein (F) gene
Target (NCBI taxonomy ID)​
human metapneumovirus (162145)
HMPV
Template accession​
KF729945.1
Taxonomy​
Viruses
Application field​
Human Pathogens
Infectious Diseases
Wet-lab tested in singleplex​
Yes, tested dye - TAMRA
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
TGCAATCAACAAAAACAAGTGTGACATTGCTGACCTGAAAATGGCCGTTAGCTTCAGTCAATTCAACAGAAGGTTTCTAAATGTTGTGCGGCAGTTTTCTGACAATGCTG
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 253.7 KBLanguage: English

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Human metapneumovirus, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with human metapneumovirus models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Human metapneumovirus facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for human metapneumovirus studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Human metapneumovirus and elevate your work to new heights.