QiagenGeneGlobe
GeneGlobe ID: DMA00612 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for Enterotoxigenic Ecoli, LT

Select a variant to see the price

Product Specification

Virulence gene detection assay targeting the E. coli heat-labile enterotoxin LT subunit B gene
Product name​
Enterotoxigenic Ecoli, LT
GeneGlobe Cat.No. (Assay ID)​
DMA00612
Target type​
Virulence
Target region​
E. coli heat-labile enterotoxin LT subunit B gene
Target (NCBI taxonomy ID)​
Enterotoxigenic Ecoli, LT
Template accession​
J01646.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ACGGAGCTCCCCAGTCTATTACAGAACTATGTTCGGAATATCGCAACACACAAATATATACGATAAATGACAAGATACTATCATATACGGAATCGATGGCAGGCAAAAGAGAAATGGTTATCATTACATTTAAGAGCGGCGCAACATTTCAGGTCG
Reaction size​
200rxns

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Enterotoxigenic Ecoli, LT, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Enterotoxigenic Ecoli, LT models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Enterotoxigenic Ecoli, LT facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Enterotoxigenic Ecoli, LT studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Enterotoxigenic Ecoli, LT and elevate your work to new heights.