GeneGlobe ID: DMA00637 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

dPCR Microbial DNA Detection Assay for htpB

Select a variant to see the price

Product Specification

Virulence gene detection assay targeting the bacterial molecular chaperone GroEL (htpB) gene
Product name​
htpB
GeneGlobe Cat.No. (Assay ID)​
DMA00637
Target type​
Virulence
Target region​
Bacterial molecular chaperone GroEL (htpB) gene
Target (NCBI taxonomy ID)​
htpB
Template accession​
CP003023.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
AAGCACGTGTTGAAGATGCTCTTCATGCTACTCGCGCTGCAGTAGAAGAAGGTATCGTTGCCGGTGGTGGTGTTGCCTTGATTCGTGCTCAGAAAGCTCTTGATTCATTGAAAGGCGATAATGACGATCAAAATATGGGTATCAATATTTTACGTCGCGCTATTGAATCTCCAATGCGTCAAATTGTTACTAACGCAGGATATGAAGCTTCTGTTGTAGTAAAC
Reaction size​
200rxns

Resources

Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for htpB, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Digital PCR applications. This premium product offers unparalleled performance for researchers working with htpB models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for htpB facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Digital PCR, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for htpB studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for htpB and elevate your work to new heights.