dPCR Microbial DNA Detection Assay for plcA

GeneGlobe ID: DMA00663 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Virulence gene detection assay targeting the bacterial 1-phosphatidylinositol phosphodiesterase gene
Product name​
plcA
GeneGlobe Cat.No. (Assay ID)​
DMA00663
Target type​
Virulence
Target region​
Bacterial 1-phosphatidylinositol phosphodiesterase gene
Target (NCBI taxonomy ID)​
phosphatidylinositol-specific phospholipase c
Template accession​
X54618.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
No
Wet-lab tested in multiplex​
No
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
AACAAAATTCAAAGAGATTGTCCAGACTGCTTATCAAGCTTCCAAAGCGGACAATAAACTTTTTCTTAACCATATTAGCGCCACTTCATTAACATTCACACCTCGTCAGTATGCTGCAGCATTAAACAACAAAGTAGAGCAATTCGTACTCAACTTAACATCGGAAAAAGTTCGAGGATT
Reaction size​
200rxns

Resources

Available Product Catalog (2)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Kit Handbooks (1)
Brochures & Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for plcA, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with phosphatidylinositol-specific phospholipase c models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for plcA facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for phosphatidylinositol-specific phospholipase c studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for plcA and elevate your work to new heights.