dPCR Microbial DNA Detection Assay for stx2A

GeneGlobe ID: DMA00678 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays

Product Specification

Virulence gene detection assay targeting the bacterial shiga toxin Stx2c subunit A gene
dPCR wet-lab verified
Product name​
stx2A
GeneGlobe Cat.No. (Assay ID)​
DMA00678
Target type​
Virulence
Target region​
Bacterial shiga toxin Stx2c subunit A gene
Target (NCBI taxonomy ID)​
shiga-like toxin II A subunit encoded by bacteriophage BP-933W
Template accession​
AB048837.1
Taxonomy​
Virulence Genes
Application field​
Microbial Virulence
Wet-lab tested in singleplex​
Yes, tested dye - TAMRA
Wet-lab tested in multiplex​
Yes
Recommended restriction enzyme​
EcoRI
Template present in Microbial DNA Positive Control​
Yes
Region of Interest​
ATCAGCGATACTGGGGACTGTGGCCGTTATACTGAATTGCCATCATCAGGGGGCGCGTTCTGTTCGCGCCGTGAATGAAGAGAGTCAACCAGAATGTCAGATAACTGGCGACAGGCCTGTTATAAAAATAAA
Reaction size​
200rxns

Product Resources

icon_0245_cc_gen_pdf-s Validation Data
File Size: 256.19 KBLanguage: English

Microbiology Research Areas

Resources

Available Product Catalog (2)
Brochures and Guides (2)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
A versatile workflow for the detection of low-abundance microbes
Kit Handbooks (1)
Technical Information (1)
Detect microbial targets – bacterial, fungal, parasitic, viral, antibiotic resistance and virulence factor genes – using digital PCR
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for stx2A, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with shiga-like toxin II A subunit encoded by bacteriophage BP-933W models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for stx2A facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for shiga-like toxin II A subunit encoded by bacteriophage BP-933W studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for stx2A and elevate your work to new heights.