GeneGlobe ID: DMA00741 | Cat. No.: 250207 | dPCR Microbial DNA Detection Assays
dPCR Microbial DNA Detection Assay for Actinobaculum schaalii
Product Specification
Bacterial detection assay
Alternative names of species: A. schaalii; Actinotignum schaalii
dPCR wet-lab validated
Alternative names of species: A. schaalii; Actinotignum schaalii
dPCR wet-lab validated
Product name
Actinobaculum schaalii
GeneGlobe Cat.No. (Assay ID)
DMA00741
Target type
Microbial Id
Target region
gyrB
Target (NCBI taxonomy ID)
Actinotignum schaalii (59505)
Actinobaculum schaalii
Actinobaculum schaalii
Template accession
CP008802.1
Taxonomy
Bacteria
Application field
Urinary Tract Infections
Wet-lab tested in singleplex
Yes, tested dye - FAM
Wet-lab tested in multiplex
No
Recommended restriction enzyme
EcoRI, PvuII, XbaI, AluI, HaeII
Template present in Microbial DNA Positive Control
No
Region of Interest
GATCGAAGTGGAAGTGGCCATGCAGTGGACCTCGGCCTACTCCGAATCGGTCAATACCTTCGCGAATACCATTAACACCACCGAAGGCGGGATGCACGAAGAAGGCTTCCGCTCCGCCCTCACCTCGGTGATCAATAAGTACGCACGCGAACACGGGCTCCTCAAAGATAAAGACTCGAATCTTTCCGGTGATGATGTGCGCGAAGGTCTTACCG
Reaction size
200rxns
Product Resources
File Size: 99.35 KBLanguage: English
Resources
Available Product Catalog (2)
Quick-Start Protocols (1)
Application Notes (2)
Technical Information (1)
Kit Handbooks (1)
Scientific Posters (1)
Brochures & Guides (2)
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the dPCR Microbial DNA Detection Assay for Actinobaculum schaalii, a cutting-edge addition to our dPCR Microbial DNA Detection Assays lineup, specifically designed for Microbial applications. This premium product offers unparalleled performance for researchers working with Actinotignum schaalii models. Leveraging advanced technology, the dPCR Microbial DNA Detection Assay for Actinobaculum schaalii facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Microbial, or any other sophisticated analyses, this product from our dPCR Microbial DNA Detection Assays collection ensures optimal efficiency and reproducibility for Actinotignum schaalii studies. Embrace the future of research with dPCR Microbial DNA Detection Assay for Actinobaculum schaalii and elevate your work to new heights.