GeneGlobe ID: ZP00005900 | Cat. No.: 339350 | miRCURY LNA miRNA Probe PCR Assays

dme-miR-87-5p miRCURY LNA miRNA Probe PCR Assay

Product Specification

Pre-designed non-validated assay.
Name​
dme-miR-87-5p (ZP00005900)
Species​
Fruit fly (Drosophila melanogaster)
Targets (mature miR)
miRBase ID​
dme-miR-87-5p
miRBase Accession​
MIMAT0020821
Mature miRNA sequence​
UCGCGCCUGUAUCUUGCUGAAC
Additional info (miRNA stem loop(s))
miRBase ID​
dme-mir-87
miRBase Accession​
MI0000382
Description​
Drosophila melanogaster miR-87 stem-loop
miRNA sequence (pre-miR)​
AACACAUUUCAUUCGCGCCUGUAUCUUGCUGAACCGCUGCCAUUAUGGCCAACGAUCCGGUUGAGCAAAAUUUCAGGUGUGUGAGAAAUGUGUUUAGCA
miRNAs amplified by this miRCURY LNA Probe PCR Assay​
dme-miR-87-5p

Resources

Quick-Start Protocols (1)
Safety Data Sheets (1)
Kit Handbooks (2)
For highly sensitive, real-time RT-PCR detection of miRNAs using hydrolysis probes
For highly sensitive, ultrafast real-time RT-PCR detection of miRNAs from exosomes, serum/plasma, and other biofluids
Certificates of Analysis (1)
Introducing the dme-miR-87-5p miRCURY LNA miRNA Probe PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA Probe PCR Assays lineup, specifically designed for Real-Time PCR applications. This premium product offers unparalleled performance for researchers working with Fruit fly models. Leveraging advanced technology, the dme-miR-87-5p miRCURY LNA miRNA Probe PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting Real-Time PCR, or any other sophisticated analyses, this product from our miRCURY LNA miRNA Probe PCR Assays collection ensures optimal efficiency and reproducibility for Fruit fly studies. Embrace the future of research with dme-miR-87-5p miRCURY LNA miRNA Probe PCR Assay and elevate your work to new heights.