GeneGlobe ID: YP00206050 | Cat. No.: 339306 | miRCURY LNA miRNA PCR Assays

hsa-miR-520h miRCURY LNA miRNA PCR Assay

Product Specification

Pre-designed assay for dPCR and qPCR. Wet-lab verified for qPCR and dPCR.
Targets similar miRNAs across multiple species.
Name​
hsa-miR-520h (YP00206050)
Species​
Human (Homo sapiens)
Wet-lab verified​
qPCR and dPCR wet-lab verified
Targets (mature miR)
miRBase ID​
hsa-miR-520h
miRBase Accession​
MIMAT0002867
Mature miRNA sequence​
ACAAAGUGCUUCCCUUUAGAGU
Alternative targets​
ppy-miR-520h
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-520h
miRBase Accession​
MI0003175
Description​
Homo sapiens miR-520h stem-loop
miRNA sequence (pre-miR)​
UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUUUGUUGUCUGAGAAAAAACAAAGUGCUUCCCUUUAGAGUUACUGUUUGGGA
miRNAs amplified by this miRCURY LNA PCR Assay​
hsa-miR-520h

Resources

안전보건자료 (1)
Download Safety Data Sheets for QIAGEN product components.
키트 안내서 (3)
For highly sensitive detection of miRNA using EvaGreen
For highly sensitive, real-time RT-PCR detection of miRNAs using SYBR Green
애플리케이션 노트 (1)
Here, we present a highly efficient, high-throughput workflow that combines two technologies, cellenONE and QIAcuity Digital PCR, to accurately analyze miRNAs in well-defined individual cells and populations of cells.
Safety Data Sheets (1)
Certificates of Analysis (1)
Introducing the hsa-miR-520h miRCURY LNA miRNA PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA PCR Assays lineup, specifically designed for RNA expression applications. This premium product offers unparalleled performance for researchers working with Bornean orangutan models. Leveraging advanced technology, the hsa-miR-520h miRCURY LNA miRNA PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA expression, or any other sophisticated analyses, this product from our miRCURY LNA miRNA PCR Assays collection ensures optimal efficiency and reproducibility for Bornean orangutan studies. Embrace the future of research with hsa-miR-520h miRCURY LNA miRNA PCR Assay and elevate your work to new heights.